DNA Interactive Virtual Lab

07 Nov 2020

                                      If you need help with this homework, Hit the Whatsapp Icon or place an order.

                                  DNA Interactive / instructions

 

Directions: Today, you will be using the Internet to test and improve you understanding of DNA.   Carefully follow the instructions below. 

 

NOTE:  shared work will result in a shared grade, split between ALL those involved in copying.

 

1. DNA Extraction virtual lab 

  1. Go to http://learn.genetics.utah.edu/content/labs/extraction/ 
  2. Click on “Start Lab”
  3. Click “next” after reading the text on each page and answering the corresponding questions on your worksheet, under “DNA Extraction”

 

2. Gel Electrophoresis virtual lab 

  1. Go to http://learn.genetics.utah.edu/content/labs/gel/ 
  2. Click on “Forward”
  3. Click “Forward” after reading the text on each page and answering the corresponding questions on your worksheet, under, under “Electrophoresis”

 

3. Transcription & Translation 

  1. Go to https://learn.genetics.utah.edu/content/basics/txtl/
  2. Click on the button that says “Choose a Gene to Begin”
  3. Use the keyboard to type in the complementary base pairs to make an mRNA strand.
  4. Translate the mRNA strand you made into amino acids.  Pay close attention to the “Universal Genetic Code” chart – all RNA messages must begin with a “Start” codon and end with a “Stop” codon, so you will have to shift the reading frame accordingly.
  5. Answer the questions on your worksheet, under “Transcription & Translation”.

 

4. DNA Replication 

  1. Go to https://educationalgames.nobelprize.org/educational/medicine/dna_double_helix/
  2. Click on “Play” arrow 
  3. Click through the information in the beginning to get to the game – you don’t need to read this stuff.
  4. Play all 3 rounds of the game.  When the game is over, try to select the correct organism that matches each DNA strand you replicate.

 

5. If you finish early, check out http://www.dnai.org/a/index.html 

  1. Choose one of the four modules (“Finding the Structure”; “Copying the Code”;

“Reading the Code”; and/or “Controlling the Code”)

  1. At the top right, click “Putting it together” 
  2. Click on the “Interactive” icon to play
  3. Try each of the other modules until the bell rings

DNA Interactive \ worksheet

 

Directions: Answer the questions on this worksheet.  Complete each section by following the instructions on the first page.

 

DNA EXTRACTION

 

  1. What are three reasons why we would need to extract DNA?                            

                                                                                                                                                                                                                                                                                                       

 

  1. Why does the DNA need to be extracted from a cell before it can be analyzed?       

 

 

  1. About how much DNA is inside every cell’s nucleus?                                         

 

GEL ELECTROPHORESIS

 

  1. What is electrophoresis used for?                                                                             

                                                                                                                  

  

                                                                                                                                                                                   

 

  1. Why is “gel” used?                                                                                                    

 

  1. What makes the DNA move?                                                                            

                                                                                                                  

                                                                                                                                                                                     

 

  1. Which strands move father?  Why do you think they are able to do this?               

                                                                                                                    

                                                                                                                                                                                   

 

  1. What is a buffer?  Why is it used in electrophoresis?                                         

 

 

  1. Why it is important to put the black (negative) cord closest to the wells where the negatively

               charged DNA was injected?                                                                                                                                                               

 

 

TRANSCRIPTION & TRANSLATION

 

  1. During transcription mRNA is translated into mRNA.  Write out the complementary mRNA strand to the DNA strand below.

                   5’AAATGCTATGGCCTCTAATTTGCTGATATCAT3’

  1. Why do you think it is important for there to be designated “Start” and “Stop” codons?  

                                                                                                                                                                                                                                                                                                       

 

     3.  Give the complement of the 3-letter mRNA code to make the correct amino acid.

          UCA ___________

          GUU ___________

          CAG ___________

          GAU ___________

 

 

                                  If you need help with this homework, Hit the Whatsapp Icon or place an order.